NDUFB11 (NM_019056) Human 3' UTR Clone

CAT#: SC201417

3' UTR clone of NADH dehydrogenase (ubiquinone) 1 beta subcomplex11 17.3kDa (NDUFB11) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NDUFB11 (NM_019056) Human 3' UTR Clone
Vector pMirTarget
Synonyms CI-ESSS; ESSS; MC1DN30; Np15; NP17.3; P17.3
ACCN NM_019056
Insert Size 131 bp
Sequence Data
>SC201417 3’UTR clone of NM_019056
The sequence shown below is from the reference sequence of NM_019056. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCAAGATCCAGCTGCCAGAGGATGAGTGACCAGTTGCTAAGTGGGGCTCAAGAAGCACCGCCTTCCCC
ACCCCCTGCCTGCCATTCTGACCTCTTCTCAGAGCACCTAATTAAAGGGGCTGAAAGTCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_019056.7
Synonyms CI-ESSS; ESSS; MC1DN30; Np15; NP17.3; P17.3
Summary The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is located at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to ubiquinone. Mutations in the human gene are associated with linear skin defects with multiple congenital anomalies 3 and mitochondrial complex I deficiency. [provided by RefSeq, Dec 2016]
Locus ID 54539
MW 4.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...