C5orf45 (MRNIP) (NM_001017987) Human 3' UTR Clone

CAT#: SC201433

3' UTR clone of chromosome 5 open reading frame 45 (C5orf45) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name C5orf45 (MRNIP) (NM_001017987) Human 3' UTR Clone
Vector pMirTarget
Synonyms C5orf45
ACCN NM_001017987
Insert Size 145 bp
Sequence Data
>SC201433 3’UTR clone of NM_001017987
The sequence shown below is from the reference sequence of NM_001017987. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTGGGGAAGACTTCGATGATGATGTGTGATCTGGGACTGGCAGGTTATTAATCGAGATACACTTGTTA
GGAGGGACAGGGTTCCCCTAAGGCACTTTTAAAGATACTCTGTAAGAACCATTAACAATAAACTTACTG
TCAATCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001017987.3
Synonyms C5orf45
Summary Plays a role in the cellular response to DNA damage and the maintenance of genome stability through its association with the MRN damage-sensing complex (PubMed:27568553). Promotes chromatin loading and activity of the MRN complex to facilitate subsequent ATM-mediated DNA damage response signaling and DNA repair (PubMed:27568553).[UniProtKB/Swiss-Prot Function]
Locus ID 51149
MW 5.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...