Cytokeratin 17 (KRT17) (NM_000422) Human 3' UTR Clone

CAT#: SC201456

3' UTR clone of keratin 17 (KRT17) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Cytokeratin 17 (KRT17) (NM_000422) Human 3' UTR Clone
Vector pMirTarget
Synonyms 39.1; CK-17; K17; PC; PC2; PCHC1
ACCN NM_000422
Insert Size 182 bp
Sequence Data
>SC201456 3’UTR clone of NM_000422
The sequence shown below is from the reference sequence of NM_000422. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCGAGCAGGTCCACCAGACCACCCGCTGAGGACTCAGCTACCCCGGCCGGCCACCCAGGAGGCAGGGA
GGCAGCCGCCCCATCTGCCCCACAGTCTCCGGCCTCTCCAGCCTCAGCCCCCTGCTTCAGTCCCTTCCC
CATGCTTCCTTGCCTGATGACAATAAAGCTTGTTGACTCAGCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000422.3
Synonyms 39.1; CK-17; K17; PC; PC2; PCHC1
Summary This gene encodes the type I intermediate filament chain keratin 17, expressed in nail bed, hair follicle, sebaceous glands, and other epidermal appendages. Mutations in this gene lead to Jackson-Lawler type pachyonychia congenita and steatocystoma multiplex. [provided by RefSeq, Aug 2008]
Locus ID 3872
MW 6.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...