SCAND1 (NM_016558) Human 3' UTR Clone

CAT#: SC201468

3' UTR clone of SCAN domain containing 1 (SCAND1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SCAND1 (NM_016558) Human 3' UTR Clone
Vector pMirTarget
Synonyms RAZ1; SDP1
ACCN NM_016558
Insert Size 151 bp
Sequence Data
>SC201468 3’UTR clone of NM_016558
The sequence shown below is from the reference sequence of NM_016558. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCCGCACGGATGTGCGCATCACTGGCTGAGCGGTGGAGCTGCGGGCGGCCAGGGCCGGGCGCTCTGTG
CGGACTGGGGCCATGATCGGGCCCGGGGGCCTGAGCCTGGGACCCCACCCCGTGTTAATGAAAAATGAG
TTTTGGCAGCGCC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016558.4
Synonyms RAZ1; SDP1
Summary This gene encodes a SCAN box domain-containing protein. The SCAN domain is a highly conserved, leucine-rich motif of approximately 60 aa originally found within a subfamily of zinc finger proteins. This gene belongs to a family of genes that encode an isolated SCAN domain, but no zinc finger motif. This protein binds to and may regulate the function of the transcription factor myeloid zinc finger 1B. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]
Locus ID 51282
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...