Aurora B (AURKB) (NM_004217) Human 3' UTR Clone

CAT#: SC201514

3' UTR clone of aurora kinase B (AURKB) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Aurora B (AURKB) (NM_004217) Human 3' UTR Clone
Vector pMirTarget
Synonyms AIK2; AIM-1; AIM1; ARK-2; ARK2; AurB; aurkb-sv1; aurkb-sv2; IPL1; PPP1R48; STK-1; STK5; STK12
ACCN NM_004217
Insert Size 167 bp
Sequence Data
>SC201514 3’UTR clone of NM_004217
The sequence shown below is from the reference sequence of NM_004217. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTCCCTCTGCCCTTCAATCTGTCGCCTGATGGTCCCTGTCATTCACTCGGGTGCGTGTGTTTGTATGT
CTGTGTATGTATAGGGGAAAGAAGGGATCCCTAACTGTTCCCTTATCTGTTTTCTACCTCCTCCTTTGT
TTAATAAAGGCTGAAGCTTTTTGTACTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004217.4
Synonyms AIK2; AIM-1; AIM1; ARK-2; ARK2; AurB; aurkb-sv1; aurkb-sv2; IPL1; PPP1R48; STK-1; STK5; STK12
Summary This gene encodes a member of the aurora kinase subfamily of serine/threonine kinases. The genes encoding the other two members of this subfamily are located on chromosomes 19 and 20. These kinases participate in the regulation of alignment and segregation of chromosomes during mitosis and meiosis through association with microtubules. A pseudogene of this gene is located on chromosome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
Locus ID 9212
MW 6.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...