RAD51C (NM_002876) Human 3' UTR Clone

CAT#: SC201518

3' UTR clone of RAD51 homolog C (S. cerevisiae) (RAD51C) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RAD51C (NM_002876) Human 3' UTR Clone
Vector pMirTarget
Synonyms BROVCA3; FANCO; R51H3; RAD51L2
ACCN NM_002876
Insert Size 171 bp
Sequence Data
>SC201518 3’UTR clone of NM_002876
The sequence shown below is from the reference sequence of NM_002876. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAGGTGTTGGAAAAACACAATTATGGTAAAATAAAGTGTTCTCCTTTTAAGGGTGGGTTTAATAACAT
ATTATGAAAGTAGTATTTTGTACTATCGTCAGGAAACCAAATAAGATATATATGTGCTCTTAATTTTAA
GTGTGTATGTGCATTAAACAAAAATTAGCTTAC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002876.4
Synonyms BROVCA3; FANCO; R51H3; RAD51L2
Summary This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Locus ID 5889
MW 6.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...