Smoothelin (SMTN) (NM_134270) Human 3' UTR Clone

CAT#: SC201525

3' UTR clone of smoothelin (SMTN) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Smoothelin (SMTN) (NM_134270) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_134270
Insert Size 188 bp
Sequence Data
>SC201525 3’UTR clone of NM_134270
The sequence shown below is from the reference sequence of NM_134270. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAACTGCGCCTGCGCGGCAAGAATGTCTAGCCTGCCCGCCCGCATGGCCAGCCAGTGGCAAGCTGCCGC
CCCCACTCTCCGGGCACCGTCTCCTGCCTGTGCGTCCGCCCACCGCTGCCCTGTCTGTTGCGACACCCT
CCCCCCCACATACACACGCAGCGTTTTGATAAATTATTGGTTTTCAACGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_134270.3
Summary This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2011]
Locus ID 6525
MW 7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...