NC2 alpha (DRAP1) (NM_006442) Human 3' UTR Clone

CAT#: SC201551

3' UTR clone of DR1-associated protein 1 (negative cofactor 2 alpha) (DRAP1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NC2 alpha (DRAP1) (NM_006442) Human 3' UTR Clone
Vector pMirTarget
Synonyms NC2-alpha
ACCN NM_006442
Insert Size 158 bp
Sequence Data
>SC201551 3’UTR clone of NM_006442
The sequence shown below is from the reference sequence of NM_006442. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGAGGACGAAGAAGATTACGACTCCTAGCGCCTTCTGCCCCCCAGACCATAGCCCCTTTTAGTTGGT
TTTAGTTGCTCTGGGGGGAGGAGAGAAGGTAGAGCTGTTCTTAAATTTATTAAAAAAAAAAATAAAAGG
GAATCTCAGTGTCTGTTCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006442.4
Synonyms NC2-alpha
Summary Transcriptional repression is a general mechanism for regulating transcriptional initiation in organisms ranging from yeast to humans. Accurate initiation of transcription from eukaryotic protein-encoding genes requires the assembly of a large multiprotein complex consisting of RNA polymerase II and general transcription factors such as TFIIA, TFIIB, and TFIID. DR1 is a repressor that interacts with the TATA-binding protein (TBP) of TFIID and prevents the formation of an active transcription complex by precluding the entry of TFIIA and/or TFIIB into the preinitiation complex. The protein encoded by this gene is a corepressor of transcription that interacts with DR1 to enhance DR1-mediated repression. The interaction between this corepressor and DR1 is required for corepressor function and appears to stabilize the TBP-DR1-DNA complex. [provided by RefSeq, Jul 2008]
Locus ID 10589
MW 6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...