MRAP (NM_206898) Human 3' UTR Clone

CAT#: SC201564

3' UTR clone of melanocortin 2 receptor accessory protein (MRAP) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MRAP (NM_206898) Human 3' UTR Clone
Vector pMirTarget
Synonyms B27; C21orf61; FALP; FGD2; GCCD2
ACCN NM_206898
Insert Size 161 bp
Sequence Data
>SC201564 3’UTR clone of NM_206898
The sequence shown below is from the reference sequence of NM_206898. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAAGCCCCTAGAGAGGAAGGGGCGGCCTGACGAGGCACTGGATGGGCCTCATGGCCTAGAAGTCCCCAC
ATTCCTTGCAACTCTGATGCTGGGCACCTACAGGCCCGAGTTTATCATTTACTGGGCAGTTCAATAAAG
TCCTCTCAACTTTTCTTGTCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_206898.2
Synonyms B27; C21orf61; FALP; FGD2; GCCD2
Summary This gene encodes a melanocortin receptor-interacting protein. The encoded protein regulates trafficking and function of the melanocortin 2 receptor in the adrenal gland. The encoded protein can also modulate signaling of other melanocortin receptors. Mutations in this gene have been associated with familial glucocorticoid deficiency type 2. Alternatively spliced transcript variants have been described. [provided by RefSeq, Dec 2009]
Locus ID 56246
MW 5.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...