ANKRD13D (NM_207354) Human 3' UTR Clone

CAT#: SC201608

3' UTR clone of ankyrin repeat domain 13 family member D (ANKRD13D) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ANKRD13D (NM_207354) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_207354
Insert Size 182 bp
Sequence Data
>SC201608 3’UTR clone of NM_207354
The sequence shown below is from the reference sequence of NM_207354. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCCTGCAGCTGTCACTCACTGAGCACTGAGCCATAGCCCCGGGAGGGCTGGCCAGGCCACTCCCTGCC
CGCTTTTGTAATTTATTTATTTATAAACTCTCTGCTGCTGAGCTTGGGGCCTGGAGCCCCAGGAATGAG
CAGGCAGGGGAGACTGAGATGGAAATAAAGAGACTGTCGCAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_207354.3
Summary The protein encoded by this gene is a member of the ankyrin repeat domain (ANKRD) 13 family, which currently consists of four proteins containing ubiquitin-interacting motifs. These proteins are integral membrane proteins that bind specifically to Lys-63-linked ubiquitin chains on membrane-bound proteins, targeting those proteins for rapid internalization. [provided by RefSeq, Dec 2016]
Locus ID 338692
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...