SCYL1 (NM_020680) Human 3' UTR Clone

CAT#: SC201627

3' UTR clone of SCY1-like 1 (S. cerevisiae) (SCYL1) transcript variant A for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SCYL1 (NM_020680) Human 3' UTR Clone
Vector pMirTarget
Synonyms GKLP; HT019; NKTL; NTKL; P105; SCAR21; TAPK; TEIF; TRAP
ACCN NM_020680
Insert Size 168 bp
Sequence Data
>SC201627 3’UTR clone of NM_020680
The sequence shown below is from the reference sequence of NM_020680. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGAAGCTGGGAGCCCGGAAGCTGGACTGAACCGTGGCGGTGGCCCTTCCCGGCTGCGGAGAGCCCGCC
CCACAGATGTATTTATTGTACAAACCATGTGAGCCCGGCCGGCCCAGCCAGGCCATCTCACGTGTACAT
AATCAGAGCCACAATAAATTCTATTTCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_020680.4
Synonyms GKLP; HT019; NKTL; NTKL; P105; SCAR21; TAPK; TEIF; TRAP
Summary This gene encodes a transcriptional regulator belonging to the SCY1-like family of kinase-like proteins. The protein has a divergent N-terminal kinase domain that is thought to be catalytically inactive, and can bind specific DNA sequences through its C-terminal domain. It activates transcription of the telomerase reverse transcriptase and DNA polymerase beta genes. The protein has been localized to the nucleus, and also to the cytoplasm and centrosomes during mitosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 57410
MW 6.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...