Sec8 (EXOC4) (NM_001037126) Human 3' UTR Clone

CAT#: SC201629

3' UTR clone of exocyst complex component 4 (EXOC4) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Sec8 (EXOC4) (NM_001037126) Human 3' UTR Clone
Vector pMirTarget
Synonyms SEC8; SEC8L1; Sec8p
ACCN NM_001037126
Insert Size 183 bp
Sequence Data
>SC201629 3’UTR clone of NM_001037126
The sequence shown below is from the reference sequence of NM_001037126. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATAGTCGGAGTGGAGAACTGCAAGGGTAGCGGCGAAGAAATCCACCAGAAAGACAATCAAAGTAACAT
TAAAAAGCTCAAATTTTACAAAAGTTAAGTTCCTGCCAACATTTTCAATTTATCATACAATTAGAAATG
TGACTCAGTCTAACAACACCCAAGAGGATAAAAGGATTAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001037126.2
Synonyms SEC8; SEC8L1; Sec8p
Summary The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Locus ID 60412
MW 7.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...