FBXL15 (NM_024326) Human 3' UTR Clone

CAT#: SC201634

3' UTR clone of F-box and leucine-rich repeat protein 15 (FBXL15) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name FBXL15 (NM_024326) Human 3' UTR Clone
Vector pMirTarget
Synonyms Fbl15; FBXO37; JET; PSD
ACCN NM_024326
Insert Size 173 bp
Sequence Data
>SC201634 3’UTR clone of NM_024326
The sequence shown below is from the reference sequence of NM_024326. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCGCACCTTTTGTCAACCTGCAGGTCTGACCCGCCTGCCAATCGGAGCACAGCTGGACTGTGTGGCTG
GGGCCTGACACTGAGCTGTAGGGAAACTGAACTGTGAGGACCTCTGGTGAGAGGCCAGTGCCCTGCCCC
ACCCTGGAGCTTCAAATAAAGAGCTTTTTACCCCC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024326.4
Synonyms Fbl15; FBXO37; JET; PSD
Summary Substrate recognition component of a SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of SMURF1, thereby acting as a positive regulator of the BMP signaling pathway. Required for dorsal/ventral pattern formation and bone mass maintenance. Also mediates ubiquitination of SMURF2 and WWP2.[UniProtKB/Swiss-Prot Function]
Locus ID 79176
MW 6.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...