U2AF35 (U2AF1) (NM_001025203) Human 3' UTR Clone

CAT#: SC201640

3' UTR clone of U2 small nuclear RNA auxiliary factor 1 (U2AF1) transcript variant b for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name U2AF35 (U2AF1) (NM_001025203) Human 3' UTR Clone
Vector pMirTarget
Synonyms FP793; RN; RNU2AF1; U2AF35; U2AFBP
ACCN NM_001025203
Insert Size 194 bp
Sequence Data
>SC201640 3’UTR clone of NM_001025203
The sequence shown below is from the reference sequence of NM_001025203. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAGATCGTGAAAGATCTGGGCGATTCTGAGCCATGCCATTTTTACCTTATGTCTGCTAGAAAGTGTTG
TAGTTGATTGACCAAACCAGTTCATAAGGGGAATTTTTTTTAAAAAACAACAAAAAAAAAAACATACAA
AGATGGGTTTCTGAATAAAATTTGTAGTGATAACAGTAAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001025203.1
Synonyms FP793; RN; RNU2AF1; U2AF35; U2AFBP
Summary This gene belongs to the splicing factor SR family of genes. U2 auxiliary factor, comprising a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the small subunit which plays a critical role in both constitutive and enhancer-dependent RNA splicing by directly mediating interactions between the large subunit and proteins bound to the enhancers. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Locus ID 7307
MW 7.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...