QIL1 (C19orf70) (NM_205767) Human 3' UTR Clone

CAT#: SC201756

3' UTR clone of chromosome 19 open reading frame 70 (C19orf70) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name QIL1 (C19orf70) (NM_205767) Human 3' UTR Clone
Vector pMirTarget
Synonyms C19orf70; MIC13; P117; QIL1
ACCN NM_205767
Insert Size 159 bp
Sequence Data
>SC201756 3’UTR clone of NM_205767
The sequence shown below is from the reference sequence of NM_205767. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGGAGTATGTGAAGGCGCGCACCAAGTAGCGAGTCAGCAGGGGCCGCCTGCCCCGGCCAGAACGGGCA
GGGCTGCCACTGACCTGAAGACTCCGGACTGGGACCCCACTCCGAGGGCAGCTCCCGGCCTTGCCGGCC
CAATAAAGGACTTCAGAAGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_205767.3
Synonyms C19orf70; MIC13; P117; QIL1
Summary Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane. Constituent of mature MICOS complex, it is required for the formation of cristae junction (CJ) and maintenance of cristae morphology. Required for the incorporation of MICOS10/MIC10 into the MICOS complex.[UniProtKB/Swiss-Prot Function]
Locus ID 125988
MW 6.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...