Myeloid zinc finger 1 (MZF1) (NM_198055) Human 3' UTR Clone

CAT#: SC201770

3' UTR clone of myeloid zinc finger 1 (MZF1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Myeloid zinc finger 1 (MZF1) (NM_198055) Human 3' UTR Clone
Vector pMirTarget
Synonyms MZF-1; MZF1B; ZFP98; ZNF42; ZSCAN6
ACCN NM_198055
Insert Size 170 bp
Sequence Data
>SC201770 3’UTR clone of NM_198055
The sequence shown below is from the reference sequence of NM_198055. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGCACCAGCGCGTCCACAGCGCCGAGTAGCTCCAGCCGGGACGCACTGTGTCCGCCATGGTCAGAACA
CCTACCTCCCCTGGTTATTGTGAGGCTGGCGATTACATAAGTATAAGCAGGTCCGCCCAGGGCTTGGCT
ACTGTAGGTGTCCAATAAACAGTAGATGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_198055.2
Synonyms MZF-1; MZF1B; ZFP98; ZNF42; ZSCAN6
Summary Binds to target promoter DNA and functions as transcription regulator. Regulates transcription from the PADI1 and CDH2 promoter. May be one regulator of transcriptional events during hemopoietic development.[UniProtKB/Swiss-Prot Function]
Locus ID 7593
MW 5.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...