JAB1 (COPS5) (NM_006837) Human 3' UTR Clone

CAT#: SC201815

3' UTR clone of COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) (COPS5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name JAB1 (COPS5) (NM_006837) Human 3' UTR Clone
Vector pMirTarget
Synonyms CSN5; JAB1; MOV-34; SGN5
ACCN NM_006837
Insert Size 184 bp
Sequence Data
>SC201815 3’UTR clone of NM_006837
The sequence shown below is from the reference sequence of NM_006837. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAACTGTTTAATCAAATTAACATCTCTTAAACAGTCTCTGAGAAGTACTTTACCTGAAAGACAGTATGA
GAAAAATATTCAAGTAACACTTTAAAACCAGTTACCCAAAATCTGATTAGAAGTATAAGGTGCTCTGAA
GTGTCCTAAATATTAATATCCTGTAATAAAGCTCTTTAAAATGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006837.3
Synonyms CSN5; JAB1; MOV-34; SGN5
Summary The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein is reported to be involved in the degradation of cyclin-dependent kinase inhibitor CDKN1B/p27Kip1. It is also known to be an coactivator that increases the specificity of JUN/AP1 transcription factors. [provided by RefSeq, Jul 2008]
Locus ID 10987
MW 7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...