ERK2 (MAPK1) (NM_138957) Human 3' UTR Clone

CAT#: SC201852

3' UTR clone of mitogen-activated protein kinase 1 (MAPK1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 5464.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ERK2 (MAPK1) (NM_138957) Human 3' UTR Clone
Vector pMirTarget
Synonyms ERK; ERK-2; ERK2; ERT1; MAPK2; NS13; p38; p40; p41; p41mapk; p42-MAPK; P42MAPK; PRKM1; PRKM2
ACCN NM_138957
Insert Size 205 bp
Sequence Data
>SC201852 3' UTR clone of NM_138957
The sequence shown below is from the reference sequence of NM_138957. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAGACTGCTAGATTCCAGCCAGGATACAGATCTTAAATTTGTCAGGTACCTGGAGTTTAATACAGTGAGC
TCTAGCAAGGGAGGCGCTGCCTTTTGTTTCTAGAATATTATGTTCCTCAAGGTCCATTATTTTGTATTCT
TTTCCAAGCTCCTTATTGGAAGGTATTTTTTTAAATTTAGAATTAAAAATTATTTAGAAAGTTAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_138957.2
Synonyms ERK; ERK-2; ERK2; ERT1; MAPK2; NS13; p38; p40; p41; p41mapk; p42-MAPK; P42MAPK; PRKM1; PRKM2
Summary This gene encodes a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The activation of this kinase requires its phosphorylation by upstream kinases. Upon activation, this kinase translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. One study also suggests that this protein acts as a transcriptional repressor independent of its kinase activity. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Two alternatively spliced transcript variants encoding the same protein, but differing in the UTRs, have been reported for this gene. [provided by RefSeq, Jan 2014]
Locus ID 5594
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...