PRA1 (RABAC1) (NM_006423) Human 3' UTR Clone

CAT#: SC201893

3' UTR clone of Rab acceptor 1 (prenylated) (RABAC1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PRA1 (RABAC1) (NM_006423) Human 3' UTR Clone
Vector pMirTarget
Synonyms PRA1; PRAF1; YIP3
ACCN NM_006423
Insert Size 193 bp
Sequence Data
>SC201893 3’UTR clone of NM_006423
The sequence shown below is from the reference sequence of NM_006423. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGGAGGAGCTGCAGATGGAACCCGTGTGAGGTGTCTTCTGGGACCTGCCGGCCTCCCGGGCCAGCTGC
CCCACCCCTGCCCATGCCTGTCCTGCACGGCTCTGCTGCTCGGGCCCACAGCGCCGTCCCATCACAAGC
CCGGGGAGGGATCCCGCCTTTGAAAATAAAGCTGTTATGGGTGTCATTCAGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006423.3
Synonyms PRA1; PRAF1; YIP3
Summary General Rab protein regulator required for vesicle formation from the Golgi complex. May control vesicle docking and fusion by mediating the action of Rab GTPases to the SNARE complexes. In addition it inhibits the removal of Rab GTPases from the membrane by GDI.[UniProtKB/Swiss-Prot Function]
Locus ID 10567
MW 6.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...