ATP5MF (NM_004889) Human 3' UTR Clone

CAT#: SC201947

3' UTR clone of ATP synthase H+ transporting mitochondrial F0 complex subunit F2 (ATP5J2) nuclear gene encoding mitochondrial protein transcript variant 1



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ATP5MF (NM_004889) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATP5J2; ATP5JL
ACCN NM_004889
Insert Size 162 bp
Sequence Data
>SC201947 3’UTR clone of NM_004889
The sequence shown below is from the reference sequence of NM_004889. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGCACGAGCGGCTCCGCAAATACCACTGAAGAGGACACACTCTGCACCCCCCCACCCCACGACCTTGG
CCCGAGCCCCTCCGTGAGGAACACAATCTCAATCGTTGCTGAATCCTTTCATATCCTAATAGGAATTAA
CCTCCAAATAAAACATGACTGGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004889.5
Synonyms ATP5J2; ATP5JL
Summary Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The catalytic portion of mitochondrial ATP synthase consists of five different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the f subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has multiple pseudogenes. Naturally occurring read-through transcription also exists between this gene and the downstream pentatricopeptide repeat domain 1 (PTCD1) gene. [provided by RefSeq, Nov 2010]
Locus ID 9551
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...