ABCB6 (NM_005689) Human 3' UTR Clone

CAT#: SC202005

3' UTR clone of ATP-binding cassette sub-family B (MDR/TAP) member 6 (ABCB6) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ABCB6 (NM_005689) Human 3' UTR Clone
Vector pMirTarget
Synonyms ABC; LAN; MTABC3; PRP; umat
ACCN NM_005689
Insert Size 196 bp
Sequence Data
>SC202005 3’UTR clone of NM_005689
The sequence shown below is from the reference sequence of NM_005689. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACACTAAGCCTCAGACCATGGAACGGTGACAAAAGTTTGGCCACTTCCCTCTCAAAGACTAACCCAGA
AGGGAATAAGATGTGTCTCCTTTCCCTGGCTTATTTCATCCTGGTCTTGGGGTATGGTGCTAGCTATGG
TAAGGGAAAGGGACCTTTCCGAAAAACATCTTTTGGGGAAATAAAAATGTGGACTGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005689.4
Synonyms ABC; LAN; MTABC3; PRP; umat
Summary This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across extra- and intra-cellular membranes. This protein is a member of the heavy metal importer subfamily and plays a role in porphyrin transport. This gene is the molecular basis of the Langereis (Lan) blood group antigen and mutations in this gene underlie familial pseudohyperkalemia and dyschromatosis universalis hereditaria. [provided by RefSeq, Mar 2017]
Locus ID 10058
MW 7.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...