ARHGAP8 (NM_181335) Human 3' UTR Clone

CAT#: SC202040

3' UTR clone of Rho GTPase activating protein 8 (ARHGAP8) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ARHGAP8 (NM_181335) Human 3' UTR Clone
Vector pMirTarget
Synonyms BPGAP1; PP610
ACCN NM_181335
Insert Size 219 bp
Sequence Data
>SC202040 3’UTR clone of NM_181335
The sequence shown below is from the reference sequence of NM_181335. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCCTGATGGCAGCCAGAAGACGTCTCTAGTGTTGCGAACACTCTGTATATTTCGAGCTACCTCCCACA
CCTGTCTGTGCACTTGTATGTTTTGTAAACTTGGCATCTGTAAAAATAACCAGCCATTAGATGAATTCA
GAACCTTCTAATGAAAACTCCATGCCTCTGGTCCTTGGACTCTTGTCCATGGTTCCTGAGCTGTGGACC
GGGATAGAATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181335.3
Synonyms BPGAP1; PP610
Summary This gene encodes a member of the RHOGAP family. GAP (GTPase-activating) family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. GAP proteins alternate between an active (GTP-bound) and inactive (GDP-bound) state based on the GTP:GDP ratio in the cell. This family member is a multidomain protein that functions to promote Erk activation and cell motility. Alternative splicing results in multiple transcript variants. Read-through transcripts from the upstream proline rich 5, renal (PRR5) gene into this gene also exist, which led to the original description of PRR5 and ARHGAP8 being a single gene. [provided by RefSeq, Nov 2010]
Locus ID 23779
MW 8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...