HAX1 (NM_001018837) Human 3' UTR Clone

CAT#: SC202116

3' UTR clone of HCLS1 associated protein X-1 (HAX1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name HAX1 (NM_001018837) Human 3' UTR Clone
Vector pMirTarget
Synonyms HCLSBP1; HS1BP1; SCN3
ACCN NM_001018837
Insert Size 204 bp
Sequence Data
>SC202116 3’UTR clone of NM_001018837
The sequence shown below is from the reference sequence of NM_001018837. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCCTGGGACGTTGGTTCCGGTCCCGGTAGCCTTGTTAACCCTCAGAGGCCTTCAAGTCCTTTCCACCT
CTCACCCATTGCCCACCATTAATAAGCTTAGCTTCTCTTGCCACCTCAGGGGCTTGGATATGTGGAATA
GTGAACTGGGGCCATGTCAGTTTGTCACTCACCCAAACTGACCAATAAAACCTTTATTTATGCTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001018837.2
Synonyms HCLSBP1; HS1BP1; SCN3
Summary The protein encoded by this gene is known to associate with hematopoietic cell-specific Lyn substrate 1, a substrate of Src family tyrosine kinases. It also interacts with the product of the polycystic kidney disease 2 gene, mutations in which are associated with autosomal-dominant polycystic kidney disease, and with the F-actin-binding protein, cortactin. It was earlier thought that this gene product is mainly localized in the mitochondria, however, recent studies indicate it to be localized in the cell body. Mutations in this gene result in autosomal recessive severe congenital neutropenia, also known as Kostmann disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 10456
MW 7.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...