MSMB (NM_002443) Human 3' UTR Clone

CAT#: SC202139

3' UTR clone of microseminoprotein beta- (MSMB) transcript variant PSP94 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MSMB (NM_002443) Human 3' UTR Clone
Vector pMirTarget
Synonyms HPC13; IGBF; MSP; MSPB; PN44; PRPS; PSP; PSP-94; PSP57; PSP94
ACCN NM_002443
Insert Size 139 bp
Sequence Data
>SC202139 3’UTR clone of NM_002443
The sequence shown below is from the reference sequence of NM_002443. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCTGTTCTGTCAGTGAATGGATAATCTAATGTGCTTCTAGTAGGCACAGGGCTCCCAGGCCAGGCCTC
ATTCTCCTCTGGCCTCTAATAGTCAATGATTGTGTAGCCATGCCTATCAGTAAAAAGATTTTTGAGCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002443.4
Synonyms HPC13; IGBF; MSP; MSPB; PN44; PRPS; PSP; PSP-94; PSP57; PSP94
Summary The protein encoded by this gene is a member of the immunoglobulin binding factor family. It is synthesized by the epithelial cells of the prostate gland and secreted into the seminal plasma. This protein has inhibin-like activity. It may have a role as an autocrine paracrine factor in uterine, breast and other female reproductive tissues. The expression of the encoded protein is found to be decreased in prostate cancer. Two alternatively spliced transcript variants encoding different isoforms are described for this gene. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 4477
MW 5.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...