Liver Carboxylesterase 1 (CES1) (NM_001266) Human 3' UTR Clone

CAT#: SC202442

3' UTR clone of carboxylesterase 1 (monocyte/macrophage serine esterase 1) (CES1) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Cited in 2 publications.

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Liver Carboxylesterase 1 (CES1) (NM_001266) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACAT; CE-1; CEH; CES2; hCE-1; HMSE; HMSE1; PCE-1; REH; SES1; TGH
ACCN NM_001266
Insert Size 228 bp
Sequence Data
>SC202442 3’UTR clone of NM_001266
The sequence shown below is from the reference sequence of NM_001266. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCACCCCAGACAGAACACATAGAGCTGTGAATGAAGATCCAGCCGGCCTTGGGAGCCTGGAGGAGCAAA
GACTGGGGTCTTTTGCGAAAGGGATTGCAGGTTCAGAAGGCATCTTACCATGGCTGGGGAATTGTCTGG
TGGTGGGGGGCAGGGGACAGAGGCCATGAAGGAGCAAGTTTTGTATTTGTGACCTCAGCTTTGGGAATA
AAGGATCTTTTGAAGGCCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001266.5
Synonyms ACAT; CE-1; CEH; CES2; hCE-1; HMSE; HMSE1; PCE-1; REH; SES1; TGH
Summary This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Locus ID 1066
MW 8.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (2)

Documents

Customer Reviews 
Loading...