C20orf132 (MROH8) (NM_213632) Human 3' UTR Clone

CAT#: SC202470

3' UTR clone of chromosome 20 open reading frame 132 (C20orf132) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name C20orf132 (MROH8) (NM_213632) Human 3' UTR Clone
Vector pMirTarget
Synonyms C20orf131; C20orf132
ACCN NM_213632
Insert Size 229 bp
Sequence Data
>SC202470 3’UTR clone of NM_213632
The sequence shown below is from the reference sequence of NM_213632. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCATATGTGGCTGTGGCTGTAAGCCCTTGAGCTTTGCCCCTCTAATGTCAGCCCCTCCCAGGATGACTG
ACCCCACACCCCAGTGGAGAGTGTTCCTTTTGGTCCCTCTCAAAGCCTGCATCTGTCATCCATTTATAA
GTCTACAGTGTTTCTGCCAAGGGATTGACATGGAGGGAGCTGGGGAGAGTGAAGGAGTCAGAATGCCTT
AATACAAACTCGTCCAACCTGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_213632.3
Synonyms C20orf131; C20orf132
Summary The protein encoded by this gene belongs to the maestro heat-like repeat family. The exact function of this gene is not known, however, in a genome-wide association study using hippocampal atrophy as a quantitative trait, this gene has been associated with Alzheimer's disease (PMID:19668339). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Locus ID 140699
MW 8.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...