Apolipoprotein D (APOD) (NM_001647) Human 3' UTR Clone

CAT#: SC202511

3' UTR clone of apolipoprotein D (APOD) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Apolipoprotein D (APOD) (NM_001647) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_001647
Insert Size 225 bp
Sequence Data
>SC202511 3’UTR clone of NM_001647
The sequence shown below is from the reference sequence of NM_001647. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCAGGTGAACTGCCCCAAGCTCTCGTAACCAGGTTCTACAGGGAGGCTGCACCCACTCCATGTTACT
TCTGCTTCGCTTTCCCCTACCCCCCCCCCATAAAGACAAACCAATCAACCACGACAAAGGAAGTTGACC
TGAACATGTAACCATGCCCTACCCTGTTACCTTGCTAGCTGCAAAATAAACTTGTTGCTGACCTGCTGT
GCTCGCAGTAGATTCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001647.4
Summary This gene encodes a component of high density lipoprotein that has no marked similarity to other apolipoprotein sequences. It has a high degree of homology to plasma retinol-binding protein and other members of the alpha 2 microglobulin protein superfamily of carrier proteins, also known as lipocalins. This glycoprotein is closely associated with the enzyme lecithin:cholesterol acyltransferase - an enzyme involved in lipoprotein metabolism. [provided by RefSeq, Aug 2008]
Locus ID 347
MW 8.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...