RAIN (RASIP1) (NM_017805) Human 3' UTR Clone

CAT#: SC202605

3' UTR clone of Ras interacting protein 1 (RASIP1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RAIN (RASIP1) (NM_017805) Human 3' UTR Clone
Vector pMirTarget
Synonyms RAIN
ACCN NM_017805
Insert Size 243 bp
Sequence Data
>SC202605 3’UTR clone of NM_017805
The sequence shown below is from the reference sequence of NM_017805. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CATGGGCCTCCCGTGGCCACGTCTCCTTGAGAACCAATACCAAACGAGCGCGCGAACCTTGAAATGTCA
CGGGCTTCTACGGACAGGAGCCCGCCTGAGCGCAAAGCTTTCTGGGAGTTGTAGTTCTTATCCCGCGTG
GAATGTTGGGAGATTGAGTTTTCGGGAAGTAGCGGATGGGACGGTGGGAGCATGGGCTTAGGATGTGAA
TGCCAGGGAGCAATAAAGGTATCCGTGGTATCGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017805.3
Synonyms RAIN
Summary Required for the proper formation of vascular structures that develop via both vasculogenesis and angiogenesis. Acts as a critical and vascular-specific regulator of GTPase signaling, cell architecture, and adhesion, which is essential for endothelial cell morphogenesis and blood vessel tubulogenesis. Regulates the activity of Rho GTPases in part by recruiting ARHGAP29 and suppressing RhoA signaling and dampening ROCK and MYH9 activities in endothelial cells (By similarity). May act as effector for Golgi-bound HRAS and other Ras-like proteins. May promote HRAS-mediated transformation. Negative regulator of amino acid starvation-induced autophagy.[UniProtKB/Swiss-Prot Function]
Locus ID 54922
MW 8.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...