Nucleostemin (GNL3) (NM_014366) Human 3' UTR Clone

CAT#: SC202661

3' UTR clone of guanine nucleotide binding protein-like 3 (nucleolar) (GNL3) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Nucleostemin (GNL3) (NM_014366) Human 3' UTR Clone
Vector pMirTarget
Synonyms C77032; E2IG3; NNP47; NS
ACCN NM_014366
Insert Size 252 bp
Sequence Data
>SC202661 3’UTR clone of NM_014366
The sequence shown below is from the reference sequence of NM_014366. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTTATGACTTCAGTACAGATTATGTGTAACAGAACAATGGCTTTTTATGATTTTTTTTTTAACATTTT
AAGCAGACTGCTAAACTGTTCTCTGTATAAGTTATGGTATGCATGAGCTGTGTAAATTTTGTGAATATG
TATTATATTAAAACCAGGCAACTTGGAATCCCTAAATTCTGTAAAAAGACAATTCATCTCATTGTGAGT
GGAAGTAGTTATCTGGAATAAAAAAAGAAGATACCTATTGAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014366.5
Synonyms C77032; E2IG3; NNP47; NS
Summary The protein encoded by this gene may interact with p53 and may be involved in tumorigenesis. The encoded protein also appears to be important for stem cell proliferation. This protein is found in both the nucleus and nucleolus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Locus ID 26354
MW 9.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...