CD19 (NM_001770) Human 3' UTR Clone

CAT#: SC202788

3' UTR clone of CD19 molecule (CD19) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CD19 (NM_001770) Human 3' UTR Clone
Vector pMirTarget
Synonyms B4; CVID3
ACCN NM_001770
Insert Size 247 bp
Sequence Data
>SC202788 3’UTR clone of NM_001770
The sequence shown below is from the reference sequence of NM_001770. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCCGCATGGGCACCTGGAGCACCAGGTGATCCTCAGGTGGCCAGCCTGGATCTCCTCAAGTCCCCAAG
ATTCACACCTGACTCTGAAATCTGAAGACCTCGAGCAGATGATGCCAACCTCTGGAGCAATGTTGCTTA
GGATGTGTGCATGTGTGTAAGTGTGTGTGTGTGTGTGTGTGTGTATACATGCCAGTGACACTTCCAGTC
CCCTTTGTATTCCTTAAATAAACTCAATGAGCTCTTCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001770.6
Synonyms B4; CVID3
Summary This gene encodes a member of the immunoglobulin gene superfamily. Expression of this cell surface protein is restricted to B cell lymphocytes. This protein is a reliable marker for pre-B cells but its expression diminishes during terminal B cell differentiation in antibody secreting plasma cells. The protein has two N-terminal extracellular Ig-like domains separated by a non-Ig-like domain, a hydrophobic transmembrane domain, and a large C-terminal cytoplasmic domain. This protein forms a complex with several membrane proteins including complement receptor type 2 (CD21) and tetraspanin (CD81) and this complex reduces the threshold for antigen-initiated B cell activation. Activation of this B-cell antigen receptor complex activates the phosphatidylinositol 3-kinase signalling pathway and the subsequent release of intracellular stores of calcium ions. This protein is a target of chimeric antigen receptor (CAR) T-cells used in the treatment of lymphoblastic leukemia. Mutations in this gene are associated with the disease common variable immunodeficiency 3 (CVID3) which results in a failure of B-cell differentiation and impaired secretion of immunoglobulins. CVID3 is characterized by hypogammaglobulinemia, an inability to mount an antibody response to antigen, and recurrent bacterial infections. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2020]
Locus ID 930
MW 8.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...