PSMD1 (NM_002807) Human 3' UTR Clone

CAT#: SC202815

3' UTR clone of proteasome (prosome macropain) 26S subunit non-ATPase 1 (PSMD1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PSMD1 (NM_002807) Human 3' UTR Clone
Vector pMirTarget
Synonyms P112; Rpn2; S1
ACCN NM_002807
Insert Size 332 bp
Sequence Data
>SC202815 3’UTR clone of NM_002807
The sequence shown below is from the reference sequence of NM_002807. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAGAACCATTTGAGTATATTGATGATTAAGGGCCAGAGGATCTCACTTGCTTATCTGAAGAAGATTGT
CCAGGCTCATATTGGGAATGCTTATGAGGAAATTCATGCCGAGACCTGCTATTCAATGCATGTATCGTT
GCCTCTGCACTGACCTGAAGAACCCTGTCTCCAAGTCTTTGGTTGAAGAGAAGATATATGACTGTTGAG
TGTGCTCTTTCACAGAACTTGGTTTTCAAATAAATATAAGATCTCCAGATGGACAAGACATTTGTTTTT
CAGCCTGGGTTTTTAATAAATGTATCTAATCCTCCCCACACCATGAAATGCCTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002807.4
Synonyms P112; Rpn2; S1
Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes the largest non-ATPase subunit of the 19S regulator lid, which is responsible for substrate recognition and binding. There is evidence that this proteasome and its subunits interact with viral proteins, including those of coronaviruses. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Aug 2020]
Locus ID 5707
MW 12.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...