DDIT3 (NM_004083) Human 3' UTR Clone

CAT#: SC202851

3' UTR clone of DNA-damage-inducible transcript 3 (DDIT3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name DDIT3 (NM_004083) Human 3' UTR Clone
Vector pMirTarget
Synonyms AltDDIT3; C/EBPzeta; CEBPZ; CHOP; CHOP-10; CHOP10; GADD153
ACCN NM_004083
Insert Size 246 bp
Sequence Data
>SC202851 3’UTR clone of NM_004083
The sequence shown below is from the reference sequence of NM_004083. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCGAATGGTGAATCTGCACCAAGCATGAACAATTGGGAGCATCAGTCCCCCACTTGGGCCACACTAC
CCACCTTTCCCAGAAGTGGCTACTGACTACCCTCTCACTAGTGCCAATGATGTGACCCTCAATCCCACA
TACGCAGGGGGAAGGCTTGGAGTAGACAAAAGGAAAGGTCTCAGCTTGTATATAGAGATTGTACATTTA
TTTATTACTGTCCCTATCTATTAAAGTGACTTTCTATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004083.6
Synonyms AltDDIT3; C/EBPzeta; CEBPZ; CHOP; CHOP-10; CHOP10; GADD153
Summary This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified. [provided by RefSeq, Aug 2010]
Locus ID 1649
MW 8.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...