U1A (SNRPA) (NM_004596) Human 3' UTR Clone

CAT#: SC202944

3' UTR clone of small nuclear ribonucleoprotein polypeptide A (SNRPA) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name U1A (SNRPA) (NM_004596) Human 3' UTR Clone
Vector pMirTarget
Synonyms Mud1; U1-A; U1A
ACCN NM_004596
Insert Size 252 bp
Sequence Data
>SC202944 3’UTR clone of NM_004596
The sequence shown below is from the reference sequence of NM_004596. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCATGAAGATCTCCTTTGCCAAGAAGTAGCACCTTTTCCCCCCATGCCTGCCCCTTCCCCTGTTCTGG
GGCCACCCCTTTCCCCCTTGGCTCAGCCCCCTGAAGGTAAGTCCCCCCTTGGGGGCCTTCTTGGAGCCG
TGTGTGAGTGAGTGGTCGCCACACAGCATTGTACCCAGAGTCTGTCCCCAGACATTGCACCTGGCGCTG
TTAGGCCGGAATTAAAGTGGCTTTTTGAGGTTTGGTTTTTCACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004596.5
Synonyms Mud1; U1-A; U1A
Summary The protein encoded by this gene associates with stem loop II of the U1 small nuclear ribonucleoprotein, which binds the 5' splice site of precursor mRNAs and is required for splicing. The encoded protein autoregulates itself by polyadenylation inhibition of its own pre-mRNA via dimerization and has been implicated in the coupling of splicing and polyadenylation. [provided by RefSeq, Oct 2010]
Locus ID 6626
MW 9.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...