GCDH (NM_013976) Human 3' UTR Clone

CAT#: SC202966

3' UTR clone of glutaryl-Coenzyme A dehydrogenase (GCDH) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GCDH (NM_013976) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACAD5; GCD
ACCN NM_013976
Insert Size 256 bp
Sequence Data
>SC202966 3’UTR clone of NM_013976
The sequence shown below is from the reference sequence of NM_013976. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCTTAAAAAGAAGATGGAATTCTCTGTAGAGCGTCTCAATCCACTTTTAACCATGGATGAGAGCAGAC
TCCATTTACCCTGAAATAGCAGCTTCTCTTGAGAGGAGAGTGACATGGAAGCAACTCCGTCTGCTGCAG
CTGACCCCCTCACACTGAGTTCACAGTGCGCCCTCCCTCCCTCCCATCTGGGGGTAGTGCCTTATGCTG
GGTGTTGGAGCAGAGTGAGGGAGAGGAAAATAAAGACCTGCACATCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_013976.5
Synonyms ACAD5; GCD
Summary The protein encoded by this gene belongs to the acyl-CoA dehydrogenase family. It catalyzes the oxidative decarboxylation of glutaryl-CoA to crotonyl-CoA and CO(2) in the degradative pathway of L-lysine, L-hydroxylysine, and L-tryptophan metabolism. It uses electron transfer flavoprotein as its electron acceptor. The enzyme exists in the mitochondrial matrix as a homotetramer of 45-kD subunits. Mutations in this gene result in the metabolic disorder glutaric aciduria type 1, which is also known as glutaric acidemia type I. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 12. [provided by RefSeq, Mar 2013]
Locus ID 2639
MW 9.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...