FXYD3 (NM_001136008) Human 3' UTR Clone

CAT#: SC203001

3' UTR clone of FXYD domain containing ion transport regulator 3 (FXYD3) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name FXYD3 (NM_001136008) Human 3' UTR Clone
Vector pMirTarget
Synonyms MAT8; PLML
ACCN NM_001136008
Insert Size 275 bp
Sequence Data
>SC203001 3’UTR clone of NM_001136008
The sequence shown below is from the reference sequence of NM_001136008. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAATGCAAGTTTGGCCAGAAGTCCGGGTAAGATACTGTTCCGGCATGCCCGCCTCAGGCTGACTGGACG
CTTTTCAGGGTGAAAGGGCTAACTCTCCCAGCAGGAGAGGCCTCGGGGCTCTGCCCTTTAGAGTTCCTG
CCGCTAAGATTTCCAGGTTTATTGTTTCTAGCTGGTAATCCCCAGGGGGCCCCAAATCCTGAAATGCTT
TGGCCCCTGGGATTGCACAACCCCCCAAATGGAAAGGCAGCCAGGAAGACATGTCTGGGCAGGCTAAG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001136008.2
Synonyms MAT8; PLML
Summary This gene belongs to a small family of FXYD-domain containing regulators of Na+/K+ ATPases which share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD, and containing 7 invariant and 6 highly conserved amino acids. This gene encodes a cell membrane protein that may regulate the function of ion-pumps and ion-channels. This gene may also play a role in tumor progression. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2008]
Locus ID 5349
MW 9.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...