Lipoprotein a (LPA) (NM_005577) Human 3' UTR Clone

CAT#: SC203034

3' UTR clone of lipoprotein Lp(a) (LPA) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Lipoprotein a (LPA) (NM_005577) Human 3' UTR Clone
Vector pMirTarget
Synonyms AK38; APOA; LP
ACCN NM_005577
Insert Size 277 bp
Sequence Data
>SC203034 3’UTR clone of NM_005577
The sequence shown below is from the reference sequence of NM_005577. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGATTGAGGGAATGATGAGAAATAATTAATTGGACGGGAGACAGAGTGAAGCATCAACCTACTTAGAA
GCTGAAACGTGGGTAAGGATTTAGCATGCTGGAAATAATAGACAGCAATCAAACGAAGACACTGTTCCC
AGCTACCAGCTATGCCAAACCTTGGCATTTTTGGTATTTTTGTGTATAAGCTTTTAAGGTCTGACTGAC
AAATTCTGTATTAAGGTGTCATAGCTATGACATTTGTTAAAAATAAACTCTGCACTTATTTTGATTTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005577.4
Synonyms AK38; APOA; LP
Summary The protein encoded by this gene is a serine proteinase that inhibits the activity of tissue-type plasminogen activator I. The encoded protein constitutes a substantial portion of lipoprotein(a) and is proteolytically cleaved, resulting in fragments that attach to atherosclerotic lesions and promote thrombogenesis. Elevated plasma levels of this protein are linked to atherosclerosis. Depending on the individual, the encoded protein contains 2-43 copies of kringle-type domains. The allele represented here contains 15 copies of the kringle-type repeats and corresponds to that found in the reference genome sequence. [provided by RefSeq, Dec 2009]
Locus ID 4018
MW 10.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...