HLA DM (HLA-DMA) (NM_006120) Human 3' UTR Clone

CAT#: SC203075

3' UTR clone of major histocompatibility complex class II DM alpha (HLA-DMA) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name HLA DM (HLA-DMA) (NM_006120) Human 3' UTR Clone
Vector pMirTarget
Synonyms D6S222E; DMA; HLADM; RING6
ACCN NM_006120
Insert Size 276 bp
Sequence Data
>SC203075 3’UTR clone of NM_006120
The sequence shown below is from the reference sequence of NM_006120. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACTTCCGGAAGCCTTGCTCAGGTGACTGATTCTTCCAGACCAGAGTTTGATGCCAGCAGCTTCGGCCA
TCCAAACAGAGGATGCTCAGATTTCTCACATCCTGCCCAGGATCTCCTCTTAGGGTAGAAGTCTCTGGG
ACATCCCTGGGGTGTGTGTGTAGATTTCCCACCTGGGGACTCTGCTGTCCCTGGGCTTGCATCCCAGGG
ATCCCAGAGTGGCCTGCCTATCACAACCACATCCCTTCCCCCCACAAGGCAATAAATCTCATTTCTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006120.4
Synonyms D6S222E; DMA; HLADM; RING6
Summary HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]
Locus ID 3108
MW 10.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...