Geminin (GMNN) (NM_015895) Human 3' UTR Clone

CAT#: SC203092

3' UTR clone of geminin DNA replication inhibitor (GMNN) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Geminin (GMNN) (NM_015895) Human 3' UTR Clone
Vector pMirTarget
Synonyms Gem; MGORS6
ACCN NM_015895
Insert Size 330 bp
Sequence Data
>SC203092 3’UTR clone of NM_015895
The sequence shown below is from the reference sequence of NM_015895. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCTCTACGGATGCAAAGCCATGTATATGAAATGCATTAATATTTGACTGTTGAGAATTTTACTGCCGA
AGTTTACCTCCACTAGTTCTTTGTAGCAGAGTACATAACTACATAATGCCAACTCTGGAATCAAATTTC
CTTGTTTGAATCCTGGGACCCTATTGCATTAAAGTACAAATACTATGTATTTTTAATCTATGATGGTTT
ATGTGAATAGGATTTTCTCAGTTGTCAGCCATGACTTATGTTTATTACTAAATAAACTTCAAACTCCTG
TTGAACATTGTGTATAACTTAGAATAATGAAATATAAGGAGTATGTGTAGAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015895.5
Synonyms Gem; MGORS6
Summary This gene encodes a protein that plays a critical role in cell cycle regulation. The encoded protein inhibits DNA replication by binding to DNA replication factor Cdt1, preventing the incorporation of minichromosome maintenance proteins into the pre-replication complex. The encoded protein is expressed during the S and G2 phases of the cell cycle and is degraded by the anaphase-promoting complex during the metaphase-anaphase transition. Increased expression of this gene may play a role in several malignancies including colon, rectal and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and two pseudogenes of this gene are located on the short arm of chromosome 16. [provided by RefSeq, Oct 2011]
Locus ID 51053
MW 12.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...