HOMER3 (NM_001145724) Human 3' UTR Clone

CAT#: SC203123

3' UTR clone of homer homolog 3 (Drosophila) (HOMER3) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name HOMER3 (NM_001145724) Human 3' UTR Clone
Vector pMirTarget
Synonyms HOMER-3; VESL3
ACCN NM_001145724
Insert Size 282 bp
Sequence Data
>SC203123 3’UTR clone of NM_001145724
The sequence shown below is from the reference sequence of NM_001145724. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGCCCGCCTGGCTGAGGCTGCGCCCTGAGCCGGGGCTGGTTTTCTATGAACGATTCCGGCCTGGGAT
GCGGGCCAGGCTGCAGGCGGCATAGTTGGGCCCATTCGTCCTGGAAAGGGACTGGGGGGTCCCAACTTA
GCCCTGGGTGGGCCGGGCCGGGCTGGGCTGGGGTGGGCCCCAGTCGGCTCTGGTTGTTGGCAGCTTTGG
GGCTGTTTTTGAGCTTCTCATTGTGTAGAATTTCTAGATCCCCCGATTACATTTCTAAGCGTGGCAAAA
AAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001145724.1
Synonyms HOMER-3; VESL3
Summary This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
Locus ID 9454
MW 9.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...