EPHA8 (NM_001006943) Human 3' UTR Clone

CAT#: SC203134

3' UTR clone of EPH receptor A8 (EPHA8) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name EPHA8 (NM_001006943) Human 3' UTR Clone
Vector pMirTarget
Synonyms EEK; EK3; HEK3
ACCN NM_001006943
Insert Size 272 bp
Sequence Data
>SC203134 3’UTR clone of NM_001006943
The sequence shown below is from the reference sequence of NM_001006943. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCAGAGCTGGAGGCTCTTCATTGCCTTTAGAAAAGTGGAACACATTCTATAAGTAAGAGAAATCCCAAA
AGCTCAGAGGCAGGCTAGTGTGGCCGTCGAAAGCCTAGGTTCCAGAACTTTCCCTCTCTGTGCCTCAGT
TTCCTCCCTGGTGCAATGGGAATAATAGTACCTGCCTGAGGTCCTCTCAGGAGGCTTAAATGAGAGGAA
TGAAATTGCTTAGCCCAGCACCTGGCCCGTGGTAAATGCTCAATAAATGTCATTAAAAAATAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001006943.3
Synonyms EEK; EK3; HEK3
Summary This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
Locus ID 2046
MW 9.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...