STAT4 (NM_003151) Human 3' UTR Clone

CAT#: SC203255

3' UTR clone of signal transducer and activator of transcription 4 (STAT4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name STAT4 (NM_003151) Human 3' UTR Clone
Vector pMirTarget
Synonyms SLEB11
ACCN NM_003151
Insert Size 294 bp
Sequence Data
>SC203255 3’UTR clone of NM_003151
The sequence shown below is from the reference sequence of NM_003151. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCAATGAAGTCTCCTTATTCTGCTGAATGACAGGATAAACTCTGACGCACCAAGAAAGGAAGCAAATGA
AAAAGTTTAAAGACTGTTCTTTGCCCAATAACCACATTTTATTTCTTCAGCTTTGTAAATACCAGGTTC
TAGGAAATGTTTGACATCTGAAGCTCTCTTCACACTCCCGTGGCACTCCTCAATTGGGAGTGTTGTGAC
TGAAATGCTTGAAACCAAAGCTTCAGATAAACTTGCAAGATAAGACAACTTTAAGAAACCAGTGTTAAT
AACAATATTAACAGAAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003151.4
Synonyms SLEB11
Summary The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is essential for mediating responses to IL12 in lymphocytes, and regulating the differentiation of T helper cells. Mutations in this gene may be associated with systemic lupus erythematosus and rheumatoid arthritis. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Aug 2011]
Locus ID 6775
MW 11.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...