MYH7B (NM_020884) Human 3' UTR Clone

CAT#: SC203268

3' UTR clone of myosin heavy chain 7B cardiac muscle beta (MYH7B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MYH7B (NM_020884) Human 3' UTR Clone
Vector pMirTarget
Synonyms MHC14; MYH14
ACCN NM_020884
Insert Size 279 bp
Sequence Data
>SC203268 3’UTR clone of NM_020884
The sequence shown below is from the reference sequence of NM_020884. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACGCCCTGGGCCCCAAGCACAAGGAGTGACGGCCTGACCCCCTGGGCTCTAAAGAGGAATGTCTGCTG
TTGCACATCTGGCTGAGGCCACCTGCCCCGATCCTGCCATCTCTGCATCGCCCCCTGCTGCCTTCAGCC
TTCCCTGGGCCCTGAATAAACACCACAGCCAGTTTCCTTCTCATTCTTTTCTTTGGGGTTCAGGAGGAA
AAACACAGTCCTAGGGACAAAAGCCAGGTCCACAGCAGTCATTTTTAAAATAAAGTTATTTAATAGTCT
CCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_020884.7
Synonyms MHC14; MYH14
Summary The myosin II molecule is a multi-subunit complex consisting of two heavy chains and four light chains. This gene encodes a heavy chain of myosin II, which is a member of the motor-domain superfamily. The heavy chain includes a globular motor domain, which catalyzes ATP hydrolysis and interacts with actin, and a tail domain in which heptad repeat sequences promote dimerization by interacting to form a rod-like alpha-helical coiled coil. This heavy chain subunit is a slow-twitch myosin. Alternatively spliced transcript variants have been found, but the full-length nature of these variants is not determined. [provided by RefSeq, Mar 2010]
Locus ID 57644
MW 10.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...