OMA1 (NM_145243) Human 3' UTR Clone

CAT#: SC203330

3' UTR clone of OMA1 homolog zinc metallopeptidase (S. cerevisiae) (OMA1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name OMA1 (NM_145243) Human 3' UTR Clone
Vector pMirTarget
Synonyms 2010001O09Rik; DAB1; MPRP-1; MPRP1; peptidase; YKR087C; ZMPOMA1
ACCN NM_145243
Insert Size 276 bp
Sequence Data
>SC203330 3’UTR clone of NM_145243
The sequence shown below is from the reference sequence of NM_145243. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACATAGTTGAGAAAAGAACGGGCAGTTGAATTAAAATTTATGAGACACAAGATATATGAAGAATGTTG
CAGTCCTTATCATTTTATGTTACTTTTTAAAAAATGATGTTTGAAGTGAAAAAAAAAAGGATATTCAGG
GTCAAATCATGTACATTACAGATATTATCTAAATTCTTCTAGAATTTATTTTTCATGAAATATTGATGT
ATTTTAATCTATGTTAAAATATCTTCAATGAGGAAAATGTCACAGAATAAATTTATATTACACATTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_145243.5
Synonyms 2010001O09Rik; DAB1; MPRP-1; MPRP1; peptidase; YKR087C; ZMPOMA1
Summary Metalloprotease that is part of the quality control system in the inner membrane of mitochondria. Following stress conditions that induce loss of mitochondrial membrane potential, mediates cleavage of OPA1 at S1 position, leading to OPA1 inactivation and negative regulation of mitochondrial fusion. May also cleave UQCC3 under these conditions. Its role in mitochondrial quality control is essential for regulating lipid metabolism as well as to maintain body temperature and energy expenditure under cold-stress conditions.[UniProtKB/Swiss-Prot Function]
Locus ID 115209
MW 11.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...