Eph receptor A6 (EPHA6) (NM_173655) Human 3' UTR Clone

CAT#: SC203413

3' UTR clone of EPH receptor A6 (EPHA6) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Eph receptor A6 (EPHA6) (NM_173655) Human 3' UTR Clone
Vector pMirTarget
Synonyms EHK-2; EHK2; EK12; EPA6; HEK12; PRO57066
ACCN NM_173655
Insert Size 277 bp
Sequence Data
>SC203413 3’UTR clone of NM_173655
The sequence shown below is from the reference sequence of NM_173655. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTAACACTTAACCTCTGCTATTCTGCATAAATTCTGAGAAAAGCCAAATTTTCTGTCGGTCTAAGAAGA
CATAGCCTACACCCAACTGGAGATAATTATAAAAAATAATGAAGCAGCATGAGGGGAAGGTATTTAATG
TGTATTTTAAAGTTGGGAGAGATTCTCCTTCACCTAATTTAGGTGTTTGTGAATTGGCTTGACTTTTTG
AAGTTAATTTTTAAGCCTTGAACATGTCCAACTTTAAGAACTTTAAGAATAAATATTTTAACACAAGTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_173655.4
Synonyms EHK-2; EHK2; EK12; EPA6; HEK12; PRO57066
Summary Receptor tyrosine kinase which binds promiscuously GPI-anchored ephrin-A family ligands residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 285220
MW 10.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...