Siglec 7 (SIGLEC7) (NM_014385) Human 3' UTR Clone

CAT#: SC203601

3' UTR clone of sialic acid binding Ig-like lectin 7 (SIGLEC7) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Siglec 7 (SIGLEC7) (NM_014385) Human 3' UTR Clone
Vector pMirTarget
Synonyms AIRM-1; AIRM1; CD328; CDw328; D-siglec; p75; p75/AIRM1; QA79; SIGLEC-7; SIGLEC19P; SIGLECP2
ACCN NM_014385
Insert Size 311 bp
Sequence Data
>SC203601 3’UTR clone of NM_014385
The sequence shown below is from the reference sequence of NM_014385. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGTACTCAGAGATCAAGATCCCCAAGTAAGAAAATGCAGAGGCTCGGGCTTGTTTGAGGGTTCACGAC
CCCTCCAGCAAAGGAGTCTGAGGCTGATTCCAGTAGAATTAGCAGCCCTCAATGCTGTGCAACAAGACA
TCAGAACTTATTCCTCTTGTCTAACTGAAAATGCATGCCTGATGACCAAACTCTCCCTTTCCCCATCCA
ATCGGTCCACACTCCCCGCCCTGGCCTCTGGTACCCACCATTCTCCTCTGTACTTCTCTAAGGATGACT
ACTTTAGATTCCGAATATAGTGAGATTGTAACGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014385.4
Synonyms AIRM-1; AIRM1; CD328; CDw328; D-siglec; p75; p75/AIRM1; QA79; SIGLEC-7; SIGLEC19P; SIGLECP2
Summary Putative adhesion molecule that mediates sialic-acid dependent binding to cells. Preferentially binds to alpha-2,3- and alpha-2,6-linked sialic acid. Also binds disialogangliosides (disialogalactosyl globoside, disialyl lactotetraosylceramide and disialyl GalNAc lactotetraoslylceramide). The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. In the immune response, may act as an inhibitory receptor upon ligand induced tyrosine phosphorylation by recruiting cytoplasmic phosphatase(s) via their SH2 domain(s) that block signal transduction through dephosphorylation of signaling molecules. Mediates inhibition of natural killer cells cytotoxicity. May play a role in hemopoiesis. Inhibits differentiation of CD34+ cell precursors towards myelomonocytic cell lineage and proliferation of leukemic myeloid cells (in vitro).[UniProtKB/Swiss-Prot Function]
Locus ID 27036
MW 11.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...