MNK2 (MKNK2) (NM_017572) Human 3' UTR Clone

CAT#: SC203729

3' UTR clone of MAP kinase interacting serine/threonine kinase 2 (MKNK2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MNK2 (MKNK2) (NM_017572) Human 3' UTR Clone
Vector pMirTarget
Synonyms GPRK7; MNK2
ACCN NM_017572
Insert Size 298 bp
Sequence Data
>SC203729 3’UTR clone of NM_017572
The sequence shown below is from the reference sequence of NM_017572. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGTCAGAACCGTTACTGTGAATGAGTGAAGATCCTGGAGGACCCTGGGCCCCAGGCCAGCTCCCATC
GCTGGGGGACGGTGAACGGCCATGTGTTAATGTTACGATGTTTTTAAAAGACAAAAAAAAAAAAAAAAC
CTCAAAAGTTTTTTTAAAGTGGGGGAAAAACATCCAAGCACTTTAATTCCAATGTACCAGGTGAACTGA
CGGAGCTCAGAAGTTTTCCTTTACACCAACTGTCAATGCCGGAATTTTGTATTCTGTTTTGTAAAGATT
TAATAAAAGTCAAAAAACTTGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017572.4
Synonyms GPRK7; MNK2
Summary This gene encodes a member of the calcium/calmodulin-dependent protein kinases (CAMK) Ser/Thr protein kinase family, which belongs to the protein kinase superfamily. This protein contains conserved DLG (asp-leu-gly) and ENIL (glu-asn-ile-leu) motifs, and an N-terminal polybasic region which binds importin A and the translation factor scaffold protein eukaryotic initiation factor 4G (eIF4G). This protein is one of the downstream kinases activated by mitogen-activated protein (MAP) kinases. It phosphorylates the eukaryotic initiation factor 4E (eIF4E), thus playing important roles in the initiation of mRNA translation, oncogenic transformation and malignant cell proliferation. In addition to eIF4E, this protein also interacts with von Hippel-Lindau tumor suppressor (VHL), ring-box 1 (Rbx1) and Cullin2 (Cul2), which are all components of the CBC(VHL) ubiquitin ligase E3 complex. Multiple alternatively spliced transcript variants have been found, but the full-length nature and biological activity of only two variants are determined. These two variants encode distinct isoforms which differ in activity and regulation, and in subcellular localization. [provided by RefSeq, Aug 2011]
Locus ID 2872
MW 11.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...