FBXO11 (NM_018693) Human 3' UTR Clone

CAT#: SC203918

3' UTR clone of F-box protein 11 (FBXO11) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name FBXO11 (NM_018693) Human 3' UTR Clone
Vector pMirTarget
Synonyms F-box only protein 11; F-box protein 11; FBX11; FLJ12673; MGC44383; PRMT9; ubiquitin protein ligase E3 component n-recognin 6; UBR6; UG063H01; VIT1; vitiligo-associated protein VIT-1
ACCN NM_018693
Insert Size 329 bp
Sequence Data
>SC203918 3’UTR clone of NM_018693
The sequence shown below is from the reference sequence of NM_018693. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTTTAATGATCAATGACATTGCTAACTAAGTTATAAATGAGTGAATCTCAAGTCTTTTTCCTTATCAA
GTTGAACTGGTTTAGGAGATTAGTGCCTAGAGTTAAGAGACAAATGTTTACAATACTTTTCCTTTTGTA
GCCACTTTGAGTCTGCAGTTGTCAGTAAGCCTTTTTAAAGATAGAATTTGTTTACATTCTCTGGACCTT
TTAAAATTCAGAATAGTAATATGATTATAATAAACTTCAAAGTCAAGTTATAGAAATAGATGTGAGAAA
TTGATCTGTAAATATCTGAAAATGTCTTTAGTAAACGGGTATTGCTTTTGTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018693.2
Synonyms F-box only protein 11; F-box protein 11; FBX11; FLJ12673; MGC44383; PRMT9; ubiquitin protein ligase E3 component n-recognin 6; UBR6; UG063H01; VIT1; vitiligo-associated protein VIT-1
Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Locus ID 80204
MW 12.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...