SCRIBBLE (SCRIB) (NM_182706) Human 3' UTR Clone

CAT#: SC203939

3' UTR clone of scribbled homolog (Drosophila) (SCRIB) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SCRIBBLE (SCRIB) (NM_182706) Human 3' UTR Clone
Vector pMirTarget
Synonyms CRIB1; SCRB1; SCRIB1; Vartul
ACCN NM_182706
Insert Size 268 bp
Sequence Data
>SC203939 3’UTR clone of NM_182706
The sequence shown below is from the reference sequence of NM_182706. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCCGTGGCCTGGGCCCTGTGCCCTCCTAGAGGAGCAGGCACCTCCCCCAGACTTGGGGTGGGGGCCCT
GCCAGCTCCAGCACCACCCTTGCCCCAAGTCTTTTAACCTGGGTGTTAGCATTTTAAAGAGACCCCACA
GGAGTTCTGGCCTGTGACTAACTAACTGCCCCACCCCAGCCGAGACCTCGGCGAGACTGTAACTAGTGA
TGTTTGTACAACCAAAGACTCTATTTTGTGGTTTAAGGAGAATAAAGTTGACTACATTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_182706.5
Synonyms CRIB1; SCRB1; SCRIB1; Vartul
Summary This gene encodes a protein that was identified as being similar to the Drosophila scribble protein. The mammalian protein is involved in tumor suppression pathways. As a scaffold protein involved in cell polarization processes, this protein binds to many other proteins. The encoded protein binds to papillomavirus E6 protein via its PDZ domain and the C-terminus of E6. Two alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Locus ID 23513
MW 9.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...