KCNN2 (NM_021614) Human 3' UTR Clone

CAT#: SC204183

3' UTR clone of potassium intermediate/small conductance calcium-activated channel subfamily N member 2 (KCNN2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name KCNN2 (NM_021614) Human 3' UTR Clone
Vector pMirTarget
Synonyms hSK2; KCa2.2; SK2; SKCA2; SKCa 2
ACCN NM_021614
Insert Size 344 bp
Sequence Data
>SC204183 3’UTR clone of NM_021614
The sequence shown below is from the reference sequence of NM_021614. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCACCACCAACTTCATCAGAGAGTAGCTAGAAGAGAATAAGTTAACCACAAAATAAGACTTTTTGCCAT
CATATGGTCAATATTTTAGCTTTTATTGTAAAGCCCCTATGGTTCTAATCAGCGTTATCCGGGTTCTGA
TGTCAGAATCCTGGGAACCTGAACACTAAGTTTTAGGCCAAAATGAGTGAAAACTCTTTTTTTTTCTTT
CAGATGCACAGGGAATGCACCTATTATTGCTATATAGATTGTTCCTCCTGTAATTTCACTAACTTTTTA
TTCATGCACTTCAAACAAACTTTACTACTACATTATATGATATATAATAAAAAAAGTTAATTTCTGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021614.4
Synonyms hSK2; KCa2.2; SK2; SKCA2; SKCa 2
Summary Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
Locus ID 3781
MW 13.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...