Clathrin light chain (CLTA) (NM_007096) Human 3' UTR Clone

CAT#: SC204316

3' UTR clone of clathrin light chain (Lca) (CLTA) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Clathrin light chain (CLTA) (NM_007096) Human 3' UTR Clone
Vector pMirTarget
Synonyms LCA
ACCN NM_007096
Insert Size 315 bp
Sequence Data
>SC204316 3’UTR clone of NM_007096
The sequence shown below is from the reference sequence of NM_007096. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCCTCAAGCAGGCCCCGCTGGTGCACTGAAGAGCCACCCTGTGGAAACACTACATCTGCAATATCTTA
ATCCTACTCAGTGAAGCTCTTCACAGTCATTGGATTAATTATGTTGAGTTCTTTTGGACCAAACCTTTT
TGTCTTTAGAGTTGTTCATTGTTTGTGATTGCATGTTTCCTTCCTTCAACTGTGTTCTCCCTGGCATTC
AGAGAGGAGGGAGAGGAGGAAGAGGAAGGGGAGGGAAGCTTCCCAAGAGTAGCCTCAACCTGTGCTTCT
GTGCATTATTCTGAGAATAAATTTCTGTTTCAAACTGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007096.4
Synonyms LCA
Summary Clathrin is a large, soluble protein composed of heavy and light chains. It functions as the main structural component of the lattice-type cytoplasmic face of coated pits and vesicles which entrap specific macromolecules during receptor-mediated endocytosis. This gene encodes one of two clathrin light chain proteins which are believed to function as regulatory elements. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 8 and 12. [provided by RefSeq, May 2010]
Locus ID 1211
MW 12.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...